Transcript: Mouse NM_001025562.2

Mus musculus pseudouridine synthase 1 (Pus1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pus1 (56361)
Length:
1535
CDS:
65..1246

Additional Resources:

NCBI RefSeq record:
NM_001025562.2
NBCI Gene record:
Pus1 (56361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322537 CTTTCAAGGAGCAGTACATTT pLKO_005 1062 CDS 100% 13.200 18.480 N Pus1 n/a
2 TRCN0000120142 GCTTCATAACCTCAGGATATT pLKO.1 1360 3UTR 100% 13.200 18.480 N Pus1 n/a
3 TRCN0000322533 GCTTCATAACCTCAGGATATT pLKO_005 1360 3UTR 100% 13.200 18.480 N Pus1 n/a
4 TRCN0000322535 TAGCCATTGTGAAGGGTTATG pLKO_005 867 CDS 100% 10.800 8.640 N Pus1 n/a
5 TRCN0000120145 GCCGCCTATGGCTGGAAACAA pLKO.1 58 5UTR 100% 1.875 1.500 N Pus1 n/a
6 TRCN0000322465 CTGCTACAAAGGCACCCATAA pLKO_005 673 CDS 100% 10.800 7.560 N Pus1 n/a
7 TRCN0000322467 TTAGTCCAGGCAGGTTGTATC pLKO_005 320 CDS 100% 10.800 7.560 N Pus1 n/a
8 TRCN0000120146 CCATAACTTCACCTCGCAGAA pLKO.1 697 CDS 100% 4.050 2.835 N Pus1 n/a
9 TRCN0000120143 GCAGTACATTTACCCTACCAT pLKO.1 1072 CDS 100% 3.000 2.100 N Pus1 n/a
10 TRCN0000120144 CCGCTACATTCTGGAGATGTA pLKO.1 742 CDS 100% 0.495 0.297 N Pus1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.