Transcript: Mouse NM_001029878.1

Mus musculus LON peptidase N-terminal domain and ring finger 2 (Lonrf2), mRNA.

Source:
NCBI, updated 2017-04-27
Taxon:
Mus musculus (mouse)
Gene:
Lonrf2 (381338)
Length:
5077
CDS:
1..1557

Additional Resources:

NCBI RefSeq record:
NM_001029878.1
NBCI Gene record:
Lonrf2 (381338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253467 CTGACTGAAGAGCTGATATTC pLKO_005 802 CDS 100% 13.200 18.480 N Lonrf2 n/a
2 TRCN0000253464 GACGAATATTAGTCATCATTA pLKO_005 1481 CDS 100% 13.200 18.480 N Lonrf2 n/a
3 TRCN0000191268 CGACGAATATTAGTCATCATT pLKO.1 1480 CDS 100% 5.625 4.500 N Lonrf2 n/a
4 TRCN0000253466 ATGAGGAGCTCAAAGCGAATA pLKO_005 512 CDS 100% 10.800 7.560 N Lonrf2 n/a
5 TRCN0000253465 CTGACAGGAAGAGGGTCTATG pLKO_005 845 CDS 100% 10.800 7.560 N Lonrf2 n/a
6 TRCN0000190488 GCTGACATTATGGAGGCTTTA pLKO.1 4805 3UTR 100% 10.800 7.560 N Lonrf2 n/a
7 TRCN0000201294 GAAGGTAATATGTGAGGTGTT pLKO.1 189 CDS 100% 4.050 2.835 N Lonrf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.