Transcript: Human NM_001029884.3

Homo sapiens pleckstrin homology and RhoGEF domain containing G1 (PLEKHG1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PLEKHG1 (57480)
Length:
7217
CDS:
291..4448

Additional Resources:

NCBI RefSeq record:
NM_001029884.3
NBCI Gene record:
PLEKHG1 (57480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001029884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047198 CGGCAACACATTGCATTCTTT pLKO.1 4241 CDS 100% 5.625 7.875 N PLEKHG1 n/a
2 TRCN0000047202 GCAGCAGAATGACCTTAGTTT pLKO.1 376 CDS 100% 5.625 3.938 N PLEKHG1 n/a
3 TRCN0000047200 GCTGAGTATTCCCAGTTGTAT pLKO.1 3396 CDS 100% 5.625 3.938 N PLEKHG1 n/a
4 TRCN0000047199 CGCCTGGCATATCAATGACAT pLKO.1 1148 CDS 100% 4.950 3.465 N PLEKHG1 n/a
5 TRCN0000047201 GCCTAGCAGTTCTACCATGAT pLKO.1 1829 CDS 100% 4.950 3.465 N PLEKHG1 n/a
6 TRCN0000251310 ACCATGTCTATGATAACATAA pLKO_005 2263 CDS 100% 13.200 10.560 N Plekhg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.