Transcript: Mouse NM_001029983.2

Mus musculus mannosidase, alpha, class 1B, member 1 (Man1b1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Man1b1 (227619)
Length:
3748
CDS:
118..2094

Additional Resources:

NCBI RefSeq record:
NM_001029983.2
NBCI Gene record:
Man1b1 (227619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341577 GGCTGACAGCTACTACGAATA pLKO_005 1377 CDS 100% 10.800 15.120 N Man1b1 n/a
2 TRCN0000182634 GACGGTGGAAAGCCTATTCTA pLKO.1 1791 CDS 100% 5.625 7.875 N Man1b1 n/a
3 TRCN0000200325 GAGAGCACCATTCGCATCTTA pLKO.1 982 CDS 100% 5.625 7.875 N Man1b1 n/a
4 TRCN0000352499 GAGAGCACCATTCGCATCTTA pLKO_005 982 CDS 100% 5.625 7.875 N Man1b1 n/a
5 TRCN0000198086 CCTGACCAAAGCTGAAGATTT pLKO.1 1047 CDS 100% 13.200 9.240 N Man1b1 n/a
6 TRCN0000200285 GAGCCCTGAGATTGCACATTT pLKO.1 1695 CDS 100% 13.200 9.240 N Man1b1 n/a
7 TRCN0000341642 GAGCCCTGAGATTGCACATTT pLKO_005 1695 CDS 100% 13.200 9.240 N Man1b1 n/a
8 TRCN0000341578 GGTAGTCCCAAGACTTCTTAT pLKO_005 2397 3UTR 100% 13.200 9.240 N Man1b1 n/a
9 TRCN0000219602 TAGGATTCTCCTATCCAATTC pLKO.1 3037 3UTR 100% 10.800 7.560 N Man1b1 n/a
10 TRCN0000197580 CCATACTCTGATGTGAACATT pLKO.1 1111 CDS 100% 5.625 3.938 N Man1b1 n/a
11 TRCN0000197604 CCTGTCTTTGATGAGTTGTTA pLKO.1 2993 3UTR 100% 5.625 3.938 N Man1b1 n/a
12 TRCN0000200078 CCTCCATCAAACCTCTGGTTT pLKO.1 677 CDS 100% 4.950 3.465 N Man1b1 n/a
13 TRCN0000341576 GTACCCTCGGGCAGATCATAA pLKO_005 1722 CDS 100% 0.000 0.000 N Man1b1 n/a
14 TRCN0000198363 GCCTTGAGTTTATGGGTAGAA pLKO.1 3311 3UTR 100% 4.950 2.970 N Man1b1 n/a
15 TRCN0000176800 GAAGTAGAGAAGATGAAGCAA pLKO.1 364 CDS 100% 3.000 1.800 N Man1b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.