Transcript: Mouse NM_001029990.1

Mus musculus methyltransferase like 17 (Mettl17), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mettl17 (52535)
Length:
1637
CDS:
105..1490

Additional Resources:

NCBI RefSeq record:
NM_001029990.1
NBCI Gene record:
Mettl17 (52535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254932 TATCTCTGGAGCCGACATTTA pLKO_005 384 CDS 100% 13.200 18.480 N Mettl17 n/a
2 TRCN0000183968 CCACAGACGTTGATGGACTTT pLKO.1 663 CDS 100% 4.950 6.930 N Mettl17 n/a
3 TRCN0000184560 GCTGATCGCATTGAGGTCATT pLKO.1 930 CDS 100% 4.950 3.960 N Mettl17 n/a
4 TRCN0000254931 AGAGCTGAGTCTGATCTATAT pLKO_005 563 CDS 100% 13.200 9.240 N Mettl17 n/a
5 TRCN0000254930 TGATCGCTCCATCCGAGTTTC pLKO_005 1432 CDS 100% 10.800 7.560 N Mettl17 n/a
6 TRCN0000254933 GGAAATATTCTCTATGGTAAT pLKO_005 1214 CDS 100% 10.800 6.480 N Mettl17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.