Transcript: Human NM_001030007.2

Homo sapiens adaptor related protein complex 1 subunit gamma 1 (AP1G1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
AP1G1 (164)
Length:
6611
CDS:
76..2553

Additional Resources:

NCBI RefSeq record:
NM_001030007.2
NBCI Gene record:
AP1G1 (164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001030007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293941 TTGCGAGTCCTAGCCATAAAT pLKO_005 997 CDS 100% 15.000 21.000 N AP1G1 n/a
2 TRCN0000381796 AGCTAGATATGACGGACTTTG pLKO_005 2309 CDS 100% 10.800 15.120 N AP1G1 n/a
3 TRCN0000065150 GCAGGAAGTTATGTTCGTGAT pLKO.1 1369 CDS 100% 4.050 5.670 N AP1G1 n/a
4 TRCN0000286460 GCAGGAAGTTATGTTCGTGAT pLKO_005 1369 CDS 100% 4.050 5.670 N AP1G1 n/a
5 TRCN0000380765 AGGATGAAGTGTTGGATATTT pLKO_005 1589 CDS 100% 15.000 10.500 N AP1G1 n/a
6 TRCN0000379637 ATTCGTGTGAGCCAGAATTTA pLKO_005 1253 CDS 100% 15.000 10.500 N AP1G1 n/a
7 TRCN0000375824 GACAAACGCATTGGCTATTTA pLKO_005 316 CDS 100% 15.000 10.500 N Ap1g1 n/a
8 TRCN0000380508 GACAAACGCATTGGCTATTTA pLKO_005 316 CDS 100% 15.000 10.500 N AP1G1 n/a
9 TRCN0000065148 GCCCTGGTAAATGGGAATAAT pLKO.1 1195 CDS 100% 15.000 10.500 N AP1G1 n/a
10 TRCN0000286530 GCCCTGGTAAATGGGAATAAT pLKO_005 1195 CDS 100% 15.000 10.500 N AP1G1 n/a
11 TRCN0000293896 TTGTACTGTAAACCGAATTAA pLKO_005 1698 CDS 100% 15.000 10.500 N AP1G1 n/a
12 TRCN0000375757 ACCTCATCATGTCCGGATATT pLKO_005 758 CDS 100% 13.200 9.240 N Ap1g1 n/a
13 TRCN0000381895 ACCTCATCATGTCCGGATATT pLKO_005 758 CDS 100% 13.200 9.240 N AP1G1 n/a
14 TRCN0000293897 TTACAGCCAGAATCAACATTC pLKO_005 2824 3UTR 100% 10.800 7.560 N AP1G1 n/a
15 TRCN0000065149 CCTGAACTTATGGAGATGTTT pLKO.1 580 CDS 100% 5.625 3.938 N AP1G1 n/a
16 TRCN0000065152 GCTGTTCATGTCATCAGGAAA pLKO.1 556 CDS 100% 4.950 3.465 N AP1G1 n/a
17 TRCN0000380803 CACCAGCCAGGCCAATGATTT pLKO_005 1947 CDS 100% 13.200 7.920 N AP1G1 n/a
18 TRCN0000065151 CCTCCATCACAGCATACAGTA pLKO.1 2198 CDS 100% 4.950 2.970 N AP1G1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001030007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.