Transcript: Mouse NM_001033197.2

Mus musculus expressed sequence AU015228 (AU015228), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
AU015228 (99169)
Length:
2982
CDS:
131..1450

Additional Resources:

NCBI RefSeq record:
NM_001033197.2
NBCI Gene record:
AU015228 (99169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226136 TGGGACGTTTAGTTATCATTT pLKO_005 2484 3UTR 100% 13.200 18.480 N AU015228 n/a
2 TRCN0000226134 GTCATGCGCGTTCTACGTATT pLKO_005 1091 CDS 100% 10.800 15.120 N AU015228 n/a
3 TRCN0000226135 TCTGGCGAGGGCTGCTAATAA pLKO_005 1165 CDS 100% 15.000 10.500 N AU015228 n/a
4 TRCN0000226133 CATGGATGACCAAGATGTTAT pLKO_005 901 CDS 100% 13.200 9.240 N AU015228 n/a
5 TRCN0000218707 ATGAGAAGGAGGATTGAAATG pLKO_005 458 CDS 100% 10.800 6.480 N AU015228 n/a
6 TRCN0000020722 CCATAACTACTACTTCATCAA pLKO.1 394 CDS 100% 4.950 2.475 Y GTF2E1 n/a
7 TRCN0000277958 CCATAACTACTACTTCATCAA pLKO_005 394 CDS 100% 4.950 2.475 Y GTF2E1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.