Transcript: Mouse NM_001033291.2

Mus musculus ubiquitin specific peptidase 40 (Usp40), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Mus musculus (mouse)
Gene:
Usp40 (227334)
Length:
5049
CDS:
134..3574

Additional Resources:

NCBI RefSeq record:
NM_001033291.2
NBCI Gene record:
Usp40 (227334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030896 GCTTCCAATATCTAGCTGGAA pLKO.1 3253 CDS 100% 0.264 0.211 N Usp40 n/a
2 TRCN0000295939 GGTGTTTGATATTCGAATTAA pLKO_005 2461 CDS 100% 15.000 10.500 N USP40 n/a
3 TRCN0000030897 CCTCTGCTGTTAAACATTCTT pLKO.1 2051 CDS 100% 5.625 3.938 N Usp40 n/a
4 TRCN0000030895 CCGACTGGTTAAAGCAGCAAA pLKO.1 805 CDS 100% 4.950 3.465 N Usp40 n/a
5 TRCN0000030894 GCACAGATGAAAGTACAGTTA pLKO.1 1338 CDS 100% 4.950 3.465 N Usp40 n/a
6 TRCN0000030898 GCCAATCAAATTCCTGTTGAT pLKO.1 1202 CDS 100% 0.495 0.347 N Usp40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.