Transcript: Mouse NM_001033306.1

Mus musculus src homology 2 domain-containing transforming protein B (Shb), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Shb (230126)
Length:
2762
CDS:
569..2080

Additional Resources:

NCBI RefSeq record:
NM_001033306.1
NBCI Gene record:
Shb (230126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353271 CTAAGCACCGACTCATCAAAG pLKO_005 1107 CDS 100% 10.800 15.120 N Shb n/a
2 TRCN0000346219 TAGAATGCTGTCGCCACTTAC pLKO_005 2216 3UTR 100% 10.800 15.120 N Shb n/a
3 TRCN0000346280 ATGACTACTCCGATCCCTTTG pLKO_005 1281 CDS 100% 6.000 8.400 N Shb n/a
4 TRCN0000346220 TGCGCAAACTGCGAGCTATGT pLKO_005 873 CDS 100% 4.950 6.930 N Shb n/a
5 TRCN0000346218 TACGAAGCCCAGAGGATCATG pLKO_005 1364 CDS 100% 4.950 3.465 N Shb n/a
6 TRCN0000146904 CAGAGGATCATGACAGAATTT pLKO.1 1373 CDS 100% 13.200 9.240 N SHB n/a
7 TRCN0000282026 CAGAGGATCATGACAGAATTT pLKO_005 1373 CDS 100% 13.200 9.240 N SHB n/a
8 TRCN0000149746 GATCCCTTTGATGCCAAGAAT pLKO.1 1292 CDS 100% 5.625 3.938 N SHB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.