Transcript: Mouse NM_001033311.3

Mus musculus V-set and immunoglobulin domain containing 10 (Vsig10), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Vsig10 (231668)
Length:
4054
CDS:
178..1854

Additional Resources:

NCBI RefSeq record:
NM_001033311.3
NBCI Gene record:
Vsig10 (231668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265482 AGCTTACCCAACACGAATATG pLKO_005 2213 3UTR 100% 13.200 18.480 N Vsig10 n/a
2 TRCN0000254164 TTCAGGCCTCACTCTGTATTA pLKO_005 1512 CDS 100% 13.200 9.240 N Vsig10 n/a
3 TRCN0000254165 CTGGCATACATCCAGACTTAG pLKO_005 305 CDS 100% 10.800 7.560 N Vsig10 n/a
4 TRCN0000254163 TGGAGGGCAAGAAGTTCAAAT pLKO_005 1079 CDS 100% 13.200 7.920 N Vsig10 n/a
5 TRCN0000254162 TAAGCAAGCATGGACACATTC pLKO_005 1712 CDS 100% 10.800 6.480 N Vsig10 n/a
6 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1612 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.