Transcript: Mouse NM_001033322.2

Mus musculus guanylate cyclase 1, soluble, alpha 2 (Gucy1a2), mRNA.

Source:
NCBI, updated 2015-12-24
Taxon:
Mus musculus (mouse)
Gene:
Gucy1a2 (234889)
Length:
13727
CDS:
455..2647

Additional Resources:

NCBI RefSeq record:
NM_001033322.2
NBCI Gene record:
Gucy1a2 (234889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252319 GTATTCTCACCCTGGTATAAT pLKO_005 4330 3UTR 100% 15.000 21.000 N Gucy1a2 n/a
2 TRCN0000258192 AGTACGAATGCCACGATATTG pLKO_005 2332 CDS 100% 13.200 18.480 N Gucy1a2 n/a
3 TRCN0000252322 CTACGGAAACAACTTCGATAT pLKO_005 1484 CDS 100% 10.800 15.120 N Gucy1a2 n/a
4 TRCN0000252320 AGATCGTCTCTCCAATGATTA pLKO_005 1542 CDS 100% 13.200 9.240 N Gucy1a2 n/a
5 TRCN0000252321 GAAAGAGAATCTATCACTTAA pLKO_005 1221 CDS 100% 13.200 9.240 N Gucy1a2 n/a
6 TRCN0000078322 CTGTCTTACTTTCCTTATCAA pLKO.1 1309 CDS 100% 5.625 3.938 N GUCY1A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.