Transcript: Mouse NM_001033343.1

Mus musculus Sec31 homolog B (S. cerevisiae) (Sec31b), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Sec31b (240667)
Length:
3923
CDS:
95..3571

Additional Resources:

NCBI RefSeq record:
NM_001033343.1
NBCI Gene record:
Sec31b (240667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252947 CCGCCTCTGCTGTTACTTAAC pLKO_005 3597 3UTR 100% 10.800 15.120 N Sec31b n/a
2 TRCN0000252948 CAACGGCACACTGACTCTATA pLKO_005 373 CDS 100% 13.200 9.240 N Sec31b n/a
3 TRCN0000252950 CATGCCTCCAGCACCAATTAC pLKO_005 3070 CDS 100% 13.200 9.240 N Sec31b n/a
4 TRCN0000252949 GAATTGGAAGGACCTAGTATG pLKO_005 1936 CDS 100% 10.800 7.560 N Sec31b n/a
5 TRCN0000267474 TTCGATGGCTGGATCAGTTTG pLKO_005 1064 CDS 100% 10.800 7.560 N Sec31b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11790 pDONR223 100% 26% 26.3% None (many diffs) n/a
2 ccsbBroad304_11790 pLX_304 0% 26% 26.3% V5 (many diffs) n/a
3 TRCN0000468299 GCCTTAGACCTTAACTAATAAATT pLX_317 29.2% 26% 26.3% V5 (many diffs) n/a
Download CSV