Transcript: Mouse NM_001033351.2

Mus musculus glutamate receptor ionotropic, NMDA3A (Grin3a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Grin3a (242443)
Length:
7667
CDS:
689..4036

Additional Resources:

NCBI RefSeq record:
NM_001033351.2
NBCI Gene record:
Grin3a (242443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14360 pDONR223 100% 89.1% 16.6% None (many diffs) n/a
2 ccsbBroad304_14360 pLX_304 0% 89.1% 16.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480025 CCCTACAGCAACTAATAGAGTTTA pLX_317 9.8% 89.1% 16.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV