Transcript: Mouse NM_001033430.4

Mus musculus lysine (K)-specific demethylase 7A (Kdm7a), mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Mus musculus (mouse)
Gene:
Kdm7a (338523)
Length:
9553
CDS:
140..2962

Additional Resources:

NCBI RefSeq record:
NM_001033430.4
NBCI Gene record:
Kdm7a (338523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033430.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238568 TGATCGAACTTCCAGATTTAA pLKO_005 2572 CDS 100% 15.000 21.000 N Kdm7a n/a
2 TRCN0000238567 TAAGAGATCAGCAGGTATTAT pLKO_005 5869 3UTR 100% 15.000 10.500 N Kdm7a n/a
3 TRCN0000238569 TGGATTTGATGTCCCTATTAT pLKO_005 601 CDS 100% 15.000 10.500 N Kdm7a n/a
4 TRCN0000253854 TGGATTTGATGTCCCTATTAT pLKO_005 601 CDS 100% 15.000 10.500 N KDM7A n/a
5 TRCN0000238570 TGTTAGACCTGGGCATCTTAT pLKO_005 1513 CDS 100% 13.200 9.240 N Kdm7a n/a
6 TRCN0000238566 TTGCACTATTCCTCGTGTTTA pLKO_005 2369 CDS 100% 13.200 9.240 N Kdm7a n/a
7 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 6184 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033430.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.