Transcript: Mouse NM_001033484.1

Mus musculus IQ motif containing GTPase activating protein 3 (Iqgap3), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Iqgap3 (404710)
Length:
5676
CDS:
6..4904

Additional Resources:

NCBI RefSeq record:
NM_001033484.1
NBCI Gene record:
Iqgap3 (404710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265762 AGCGAACCTGGATGCTATAAT pLKO_005 2372 CDS 100% 15.000 21.000 N Iqgap3 n/a
2 TRCN0000265739 CTGCCCAACTCCGCTTCATAA pLKO_005 5248 3UTR 100% 13.200 9.240 N Iqgap3 n/a
3 TRCN0000265740 ATAGTTCCTGACTGCGCTAAA pLKO_005 1932 CDS 100% 10.800 7.560 N Iqgap3 n/a
4 TRCN0000265741 ACCGAGAGGGACATCTATAAG pLKO_005 3495 CDS 100% 13.200 7.920 N Iqgap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09511 pDONR223 100% 85.1% 85.2% None (many diffs) n/a
2 ccsbBroad304_09511 pLX_304 0% 85.1% 85.2% V5 (many diffs) n/a
3 TRCN0000471612 TCTGGAAACGCGAGTCAAAATAGG pLX_317 5.6% 85.1% 85.2% V5 (many diffs) n/a
Download CSV