Transcript: Mouse NM_001033493.2

Mus musculus adhesion G protein-coupled receptor F2 (Adgrf2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Adgrf2 (435529)
Length:
3283
CDS:
289..2223

Additional Resources:

NCBI RefSeq record:
NM_001033493.2
NBCI Gene record:
Adgrf2 (435529)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225981 ACGTTCTCAATGCGAATTAAT pLKO_005 1012 CDS 100% 15.000 21.000 N Adgrf2 n/a
2 TRCN0000225983 ACTACACCATAGCTATTATAT pLKO_005 3096 3UTR 100% 15.000 21.000 N Adgrf2 n/a
3 TRCN0000225982 TTGCCGTTGTCGGCCGAATAA pLKO_005 1353 CDS 100% 13.200 18.480 N Adgrf2 n/a
4 TRCN0000039556 CGTTGTCGGCCGAATAAGTTA pLKO.1 1357 CDS 100% 5.625 7.875 N Adgrf2 n/a
5 TRCN0000039557 GAGGTCTTAGTCTGGAGTCAA pLKO.1 1495 CDS 100% 4.950 6.930 N Adgrf2 n/a
6 TRCN0000254672 AGGAGGATAAGGAACTATATT pLKO_005 557 CDS 100% 15.000 10.500 N Adgrf2 n/a
7 TRCN0000218282 CATTTGCAAGCAAGCTATTTA pLKO_005 905 CDS 100% 15.000 10.500 N Adgrf2 n/a
8 TRCN0000225980 TAGAATCCTGTAGGATATTAT pLKO_005 335 CDS 100% 15.000 10.500 N Adgrf2 n/a
9 TRCN0000254675 AGGAACATCTCATCAACATAT pLKO_005 929 CDS 100% 13.200 9.240 N Adgrf2 n/a
10 TRCN0000254671 CCCTTTGGTCATCGCCATTAT pLKO_005 1803 CDS 100% 13.200 9.240 N Adgrf2 n/a
11 TRCN0000254673 TAGATACTAAAGACCATAAAC pLKO_005 2443 3UTR 100% 13.200 9.240 N Adgrf2 n/a
12 TRCN0000039555 GGAAGAATTTCACGTTCTCAA pLKO.1 1001 CDS 100% 4.950 3.465 N Adgrf2 n/a
13 TRCN0000039558 CTCTCCTTATCCTCTATGGAA pLKO.1 1712 CDS 100% 3.000 2.100 N Adgrf2 n/a
14 TRCN0000254674 TGGGACTGGAGGGCTTGTAAA pLKO_005 1303 CDS 100% 13.200 7.920 N Adgrf2 n/a
15 TRCN0000039554 CCATGGCTAACCACATTCTTA pLKO.1 809 CDS 100% 5.625 3.375 N Adgrf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.