Transcript: Human NM_001033506.1

Homo sapiens cleavage stimulation factor subunit 3 (CSTF3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CSTF3 (1479)
Length:
777
CDS:
167..301

Additional Resources:

NCBI RefSeq record:
NM_001033506.1
NBCI Gene record:
CSTF3 (1479)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001033506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13838 pDONR223 100% 41.7% 6.8% None 12delC;130_131delGTinsAA;132_133ins177 n/a
2 ccsbBroad304_13838 pLX_304 0% 41.7% 6.8% V5 (not translated due to prior stop codon) 12delC;130_131delGTinsAA;132_133ins177 n/a
3 TRCN0000465550 GCCTACCGAGGCATGCGCGGTGGC pLX_317 97.8% 41.7% 6.8% V5 (not translated due to prior stop codon) 12delC;130_131delGTinsAA;132_133ins177 n/a
Download CSV