Transcript: Mouse NM_001033525.3

Mus musculus potassium inwardly-rectifying channel, subfamily K, member 6 (Kcnk6), mRNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Kcnk6 (52150)
Length:
4089
CDS:
40..981

Additional Resources:

NCBI RefSeq record:
NM_001033525.3
NBCI Gene record:
Kcnk6 (52150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068497 GTGCCTATCACCATGCTACTT pLKO.1 430 CDS 100% 4.950 3.465 N Kcnk6 n/a
2 TRCN0000068495 TGCTTTCTATTTCTGCTTCAT pLKO.1 648 CDS 100% 4.950 3.465 N Kcnk6 n/a
3 TRCN0000068494 CAAAGCCTTCTCCATCGTCTT pLKO.1 396 CDS 100% 4.050 2.835 N Kcnk6 n/a
4 TRCN0000068493 GCTGATGGTCATAGTGGCTAT pLKO.1 567 CDS 100% 4.050 2.835 N Kcnk6 n/a
5 TRCN0000068496 GTGGCTATATTCTTCCTGGTA pLKO.1 580 CDS 100% 2.640 1.848 N Kcnk6 n/a
6 TRCN0000089693 GCTTCCTAAGTGCTGGGATTA pLKO.1 3213 3UTR 100% 10.800 5.400 Y Rnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.