Transcript: Mouse NM_001033636.4

Mus musculus phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 (Prex2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Prex2 (109294)
Length:
6540
CDS:
204..608

Additional Resources:

NCBI RefSeq record:
NM_001033636.4
NBCI Gene record:
Prex2 (109294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033636.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081349 CCGGCTGATCACCTCATTTAT pLKO.1 236 CDS 100% 15.000 21.000 N Prex2 n/a
2 TRCN0000069654 CCACCGAATACCACATCTAAA pLKO.1 162 5UTR 100% 13.200 10.560 N LOC240711 n/a
3 TRCN0000081351 CTAGAGCAAACCATCACTTTA pLKO.1 411 CDS 100% 13.200 9.240 N Prex2 n/a
4 TRCN0000081350 CACCTCCAGTAGGAGAAGAAT pLKO.1 586 CDS 100% 5.625 3.938 N Prex2 n/a
5 TRCN0000081352 ACCTCATTTATCAGATCCAAA pLKO.1 246 CDS 100% 4.950 3.465 N Prex2 n/a
6 TRCN0000081348 CCGAAGACAAAGAGATGCAAA pLKO.1 667 3UTR 100% 4.950 3.465 N Prex2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2535 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 2571 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033636.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.