Transcript: Mouse NM_001033768.2

Mus musculus protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1, retrogene 1 (Pin1rt1), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Pin1rt1 (241593)
Length:
1083
CDS:
224..703

Additional Resources:

NCBI RefSeq record:
NM_001033768.2
NBCI Gene record:
Pin1rt1 (241593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265180 GACAGATGGAGAAACCGTTTG pLKO_005 594 CDS 100% 6.000 4.800 N Pin1rt1 n/a
2 TRCN0000251427 GGAATACTACTTCAATCACAT pLKO_005 283 CDS 100% 4.950 3.465 N Pin1rt1 n/a
3 TRCN0000251426 TTGACTTCAGAAGGGCAATTG pLKO_005 869 3UTR 100% 10.800 6.480 N Pin1rt1 n/a
4 TRCN0000251428 GCTGGAAGAAGTATATGAGTC pLKO_005 249 CDS 100% 4.050 2.430 N Pin1rt1 n/a
5 TRCN0000265187 AGAAACCGTTTGAGGATGCAT pLKO_005 603 CDS 100% 3.000 1.800 N Pin1rt1 n/a
6 TRCN0000296536 ACGGAGTCAGGCATCCATAAT pLKO_005 665 CDS 100% 13.200 9.240 N KIF20B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01205 pDONR223 100% 86.9% 92% None (many diffs) n/a
2 ccsbBroad304_01205 pLX_304 0% 86.9% 92% V5 (many diffs) n/a
3 TRCN0000480320 GTTTATTCAGGTGGAAAAAATGGG pLX_317 62.6% 86.9% 92% V5 (many diffs) n/a
Download CSV