Transcript: Mouse NM_001033877.4

Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17 (Adamts17), mRNA.

Source:
NCBI, updated 2015-12-24
Taxon:
Mus musculus (mouse)
Gene:
Adamts17 (233332)
Length:
6043
CDS:
102..3470

Additional Resources:

NCBI RefSeq record:
NM_001033877.4
NBCI Gene record:
Adamts17 (233332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033877.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086773 CGCTGCAAAGTAGTGACAGAA pLKO.1 696 CDS 100% 4.950 3.960 N Adamts17 n/a
2 TRCN0000086776 GCTGTTATTTCATGACCAGAA pLKO.1 2474 CDS 100% 4.050 3.240 N Adamts17 n/a
3 TRCN0000086775 GCAGTGGTGGTTGATGATAAA pLKO.1 1968 CDS 100% 13.200 9.240 N Adamts17 n/a
4 TRCN0000086777 GAGCATCTGATCAGACGCAAA pLKO.1 627 CDS 100% 4.050 2.835 N Adamts17 n/a
5 TRCN0000086774 GCGTTCACAAAGATGAACCTT pLKO.1 1138 CDS 100% 0.300 0.210 N Adamts17 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3767 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033877.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.