Transcript: Mouse NM_001033929.2

Mus musculus threonine synthase-like 2 (bacterial) (Thnsl2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Thnsl2 (232078)
Length:
2018
CDS:
103..1554

Additional Resources:

NCBI RefSeq record:
NM_001033929.2
NBCI Gene record:
Thnsl2 (232078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374590 TGAACCGCAACGACATCATTC pLKO_005 956 CDS 100% 10.800 15.120 N Thnsl2 n/a
2 TRCN0000120105 GTGGAAAGATTGTGTAGTGAA pLKO.1 1521 CDS 100% 4.950 3.960 N Thnsl2 n/a
3 TRCN0000366115 ACACCACTTCTTCGCTTATTT pLKO_005 801 CDS 100% 15.000 10.500 N Thnsl2 n/a
4 TRCN0000366113 GCTACCCAAGGACCTACATAA pLKO_005 1155 CDS 100% 13.200 9.240 N Thnsl2 n/a
5 TRCN0000366191 TCCAGATGACAACGGTGTTAA pLKO_005 629 CDS 100% 13.200 9.240 N Thnsl2 n/a
6 TRCN0000379085 ACAGCGGTGAACTACCATTAC pLKO_005 1285 CDS 100% 10.800 7.560 N Thnsl2 n/a
7 TRCN0000374533 CCAGGCTGGAATGGGATTGAA pLKO_005 1555 CDS 100% 5.625 3.938 N Thnsl2 n/a
8 TRCN0000374532 GACAAGATGTCTCAGTAGTTA pLKO_005 1600 3UTR 100% 5.625 3.938 N Thnsl2 n/a
9 TRCN0000120103 GCTGCCATTGAGAGTGTTCAA pLKO.1 544 CDS 100% 4.950 3.465 N Thnsl2 n/a
10 TRCN0000163103 GCTGCCATTGAGAGTGTTCAA pLKO.1 544 CDS 100% 4.950 3.465 N THNSL2 n/a
11 TRCN0000120104 GCTTATTCCAAGACATGACTT pLKO.1 300 CDS 100% 4.950 3.465 N Thnsl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.