Transcript: Mouse NM_001034862.2

Mus musculus glutamate rich 1 (Erich1), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Erich1 (234086)
Length:
1579
CDS:
66..1064

Additional Resources:

NCBI RefSeq record:
NM_001034862.2
NBCI Gene record:
Erich1 (234086)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001034862.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252953 ACAAACCTCAGTGACGTTATT pLKO_005 435 CDS 100% 13.200 18.480 N Erich1 n/a
2 TRCN0000252955 AGACATTTCTACCACGTTATT pLKO_005 1375 3UTR 100% 13.200 18.480 N Erich1 n/a
3 TRCN0000252952 TTTGCCTCCTCAAGGGTATAT pLKO_005 281 CDS 100% 13.200 18.480 N Erich1 n/a
4 TRCN0000252954 ATTATTGGATCACGCAGATTC pLKO_005 1021 CDS 100% 10.800 15.120 N Erich1 n/a
5 TRCN0000252951 GTCTGACAGATGGTGACATTA pLKO_005 226 CDS 100% 13.200 9.240 N Erich1 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 1170 3UTR 100% 4.950 2.475 Y Gad2 n/a
7 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 1131 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034862.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.