Transcript: Mouse NM_001034907.2

Mus musculus zinc finger CCCH-type containing 12B (Zc3h12b), mRNA.

Source:
NCBI, updated 2015-12-13
Taxon:
Mus musculus (mouse)
Gene:
Zc3h12b (547176)
Length:
3365
CDS:
858..3365

Additional Resources:

NCBI RefSeq record:
NM_001034907.2
NBCI Gene record:
Zc3h12b (547176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001034907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254969 AGCCTCATGCAACCGTGTTAT pLKO_005 3102 CDS 100% 13.200 18.480 N Zc3h12b n/a
2 TRCN0000254968 ATGATCGGTTCATAGTCAAAT pLKO_005 1693 CDS 100% 13.200 18.480 N Zc3h12b n/a
3 TRCN0000254967 ACTAGGCCCAGAATCACTTAT pLKO_005 1247 CDS 100% 13.200 9.240 N Zc3h12b n/a
4 TRCN0000254970 GATCAAGATATTCTACGTAAA pLKO_005 1602 CDS 100% 10.800 7.560 N Zc3h12b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13601 pDONR223 100% 88% 89.3% None (many diffs) n/a
2 ccsbBroad304_13601 pLX_304 0% 88% 89.3% V5 (many diffs) n/a
3 TRCN0000480515 TCATACAATACATATTCGGTTACG pLX_317 14.4% 88% 89.3% V5 (many diffs) n/a
Download CSV