Transcript: Mouse NM_001037321.1

Mus musculus F-box protein 40 (Fbxo40), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Fbxo40 (207215)
Length:
2518
CDS:
386..2518

Additional Resources:

NCBI RefSeq record:
NM_001037321.1
NBCI Gene record:
Fbxo40 (207215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252724 TTACGTTCACCTGCAACAAAT pLKO_005 1815 CDS 100% 13.200 18.480 N Fbxo40 n/a
2 TRCN0000252722 ATGCCAGGCTAGCACCAAATT pLKO_005 915 CDS 100% 13.200 9.240 N Fbxo40 n/a
3 TRCN0000217111 CGTGGATGCCAAAGACTATAA pLKO.1 1291 CDS 100% 13.200 9.240 N Fbxo40 n/a
4 TRCN0000252723 CGTGGATGCCAAAGACTATAA pLKO_005 1291 CDS 100% 13.200 9.240 N Fbxo40 n/a
5 TRCN0000252725 CTCCGGAGCTGAGTGAGAAAT pLKO_005 2040 CDS 100% 13.200 9.240 N Fbxo40 n/a
6 TRCN0000267444 GGAGCATCGATGGACTCTTTA pLKO_005 1638 CDS 100% 13.200 9.240 N Fbxo40 n/a
7 TRCN0000192820 GCTAGCACCAAATTCTTGTTT pLKO.1 922 CDS 100% 5.625 3.938 N Fbxo40 n/a
8 TRCN0000190370 CCTTCACGAGAACATCATGAA pLKO.1 715 CDS 100% 4.950 2.970 N Fbxo40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03373 pDONR223 100% 84.4% 84.6% None (many diffs) n/a
2 ccsbBroad304_03373 pLX_304 0% 84.4% 84.6% V5 (many diffs) n/a
Download CSV