Transcript: Mouse NM_001037909.3

Mus musculus RIKEN cDNA C130026I21 gene (C130026I21Rik), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
C130026I21Rik (620078)
Length:
1887
CDS:
503..1294

Additional Resources:

NCBI RefSeq record:
NM_001037909.3
NBCI Gene record:
C130026I21Rik (620078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037909.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283986 GGTGTACGTCTGTGTTGTTTA pLKO_005 1471 3UTR 100% 13.200 7.920 N C130026I21Rik n/a
2 TRCN0000269320 GTGTCAACCCTTTAGATTTAA pLKO_005 1420 3UTR 100% 15.000 7.500 Y C130026I21Rik n/a
3 TRCN0000225826 ACGTCCGAACTGGTCAAATTC pLKO_005 1027 CDS 100% 13.200 6.600 Y Sp110 n/a
4 TRCN0000269319 CTGTTTCTCCATTATTCATAA pLKO_005 1499 3UTR 100% 13.200 6.600 Y C130026I21Rik n/a
5 TRCN0000269321 GATACATGACCTCCGTGTTAG pLKO_005 1286 CDS 100% 10.800 5.400 Y C130026I21Rik n/a
6 TRCN0000178800 CAGAATGAAGAGGAGTCAGAT pLKO.1 551 CDS 100% 4.950 2.475 Y A530032D15Rik n/a
7 TRCN0000193214 CTTTGTGGAAAGATGACTCAT pLKO.1 1152 CDS 100% 4.950 2.475 Y Sp110 n/a
8 TRCN0000269318 CACCTCAGTTGAGACCTAAGG pLKO_005 1393 3UTR 100% 4.050 2.025 Y C130026I21Rik n/a
9 TRCN0000184720 CCACAATGCAATGGAGGAGTT pLKO.1 914 CDS 100% 4.050 2.025 Y A530032D15Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037909.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.