Transcript: Mouse NM_001038642.1

Mus musculus E26 avian leukemia oncogene 1, 5' domain (Ets1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ets1 (23871)
Length:
4799
CDS:
343..1404

Additional Resources:

NCBI RefSeq record:
NM_001038642.1
NBCI Gene record:
Ets1 (23871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365878 CGTGGCCTTCGCTACTATTAT pLKO_005 1252 CDS 100% 15.000 12.000 N Ets1 n/a
2 TRCN0000379005 TGTTGGTTGGACTCTTCATTT pLKO_005 1471 3UTR 100% 13.200 9.240 N Ets1 n/a
3 TRCN0000374176 CATCAAGCAAGAGGTGTTAAC pLKO_005 1017 CDS 100% 10.800 7.560 N Ets1 n/a
4 TRCN0000374240 CCTTGCAGACAGACTACTTTG pLKO_005 995 CDS 100% 10.800 7.560 N Ets1 n/a
5 TRCN0000042642 GCATCTAGAGATCCTGCAGAA pLKO.1 723 CDS 100% 4.050 2.835 N Ets1 n/a
6 TRCN0000365880 TGAAACCATATCAGGTTAATG pLKO_005 752 CDS 100% 13.200 7.920 N Ets1 n/a
7 TRCN0000005591 CTGGAATTACTCACTGATAAA pLKO.1 1105 CDS 100% 13.200 9.240 N ETS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10809 pDONR223 100% 69.2% 68.2% None (many diffs) n/a
2 ccsbBroad304_10809 pLX_304 0% 69.2% 68.2% V5 (many diffs) n/a
Download CSV