Transcript: Human NM_001039367.1

Homo sapiens ATPase H+ transporting V1 subunit E1 (ATP6V1E1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ATP6V1E1 (529)
Length:
1316
CDS:
188..778

Additional Resources:

NCBI RefSeq record:
NM_001039367.1
NBCI Gene record:
ATP6V1E1 (529)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322876 ACGATGTTGATGTCCAAATTG pLKO_005 579 CDS 100% 13.200 18.480 N ATP6V1E1 n/a
2 TRCN0000029557 CCCGAATGATTGTTCGTTGCA pLKO.1 486 CDS 100% 2.640 3.696 N ATP6V1E1 n/a
3 TRCN0000029554 GATCTATAATGGAGATCGTAA pLKO.1 643 CDS 100% 0.495 0.396 N ATP6V1E1 n/a
4 TRCN0000322878 TGGCCTAAAGGTGATGTATTT pLKO_005 1086 3UTR 100% 13.200 9.240 N ATP6V1E1 n/a
5 TRCN0000322951 TGGTGGAGTTGAGATCTATAA pLKO_005 631 CDS 100% 13.200 9.240 N ATP6V1E1 n/a
6 TRCN0000029556 CAGATGTCCAATTTGATGAAT pLKO.1 398 CDS 100% 5.625 3.938 N ATP6V1E1 n/a
7 TRCN0000322950 CAGATGTCCAATTTGATGAAT pLKO_005 398 CDS 100% 5.625 3.938 N ATP6V1E1 n/a
8 TRCN0000029555 GCAAATGCCAACAGGAAGTTT pLKO.1 749 CDS 100% 5.625 3.938 N ATP6V1E1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00137 pDONR223 98.5% 86.7% 86.7% None 276_277ins90 n/a
2 ccsbBroad304_00137 pLX_304 0% 86.7% 86.7% V5 (not translated due to prior stop codon) 276_277ins90 n/a
Download CSV