Transcript: Human NM_001039464.4

Homo sapiens maestro heat like repeat family member 7 (MROH7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MROH7 (374977)
Length:
4343
CDS:
293..4264

Additional Resources:

NCBI RefSeq record:
NM_001039464.4
NBCI Gene record:
MROH7 (374977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039464.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157045 GCTCAACATGGGCTCAAGAAA pLKO.1 943 CDS 100% 5.625 2.813 Y MROH7 n/a
2 TRCN0000153997 CCCTCAGTCAAATTCTGAAGA pLKO.1 724 CDS 100% 4.950 2.475 Y MROH7 n/a
3 TRCN0000151708 CCTCAGTCAAATTCTGAAGAT pLKO.1 725 CDS 100% 4.950 2.475 Y MROH7 n/a
4 TRCN0000153055 GATCGAGGAATTTGGAGACTT pLKO.1 2335 CDS 100% 4.950 2.475 Y MROH7 n/a
5 TRCN0000152962 GTGTTGAACCACATGCTTCTA pLKO.1 2057 CDS 100% 4.950 2.475 Y MROH7 n/a
6 TRCN0000152458 CATGCTTCTAACTCTGCCTTT pLKO.1 2068 CDS 100% 4.050 2.025 Y MROH7 n/a
7 TRCN0000153914 CCTTTGATGAAGTGACCTCAT pLKO.1 1527 CDS 100% 4.050 2.025 Y MROH7 n/a
8 TRCN0000158088 CCTGAAGAACATGGATGGGAT pLKO.1 3439 CDS 100% 2.640 1.320 Y MROH7 n/a
9 TRCN0000153841 CTATGTTGAATCTGCTCCCAA pLKO.1 426 CDS 100% 2.640 1.320 Y MROH7 n/a
10 TRCN0000156403 GCATGACTCTAATCCTGGGTT pLKO.1 1269 CDS 100% 2.640 1.320 Y MROH7 n/a
11 TRCN0000153195 GCTATATGAGAGCAACAAGCA pLKO.1 2263 CDS 100% 2.640 1.320 Y MROH7 n/a
12 TRCN0000152913 GCTGTTCTTACTTCATGGCTT pLKO.1 3756 CDS 100% 2.640 1.320 Y MROH7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039464.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.