Transcript: Human NM_001039591.3

Homo sapiens ubiquitin specific peptidase 9 X-linked (USP9X), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
USP9X (8239)
Length:
12543
CDS:
824..8488

Additional Resources:

NCBI RefSeq record:
NM_001039591.3
NBCI Gene record:
USP9X (8239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039591.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315064 GGTCGTTACAGCTAGTATTTA pLKO_005 4578 CDS 100% 15.000 21.000 N USP9X n/a
2 TRCN0000007363 CGACCCTAAACGTAGACATTA pLKO.1 6036 CDS 100% 13.200 18.480 N USP9X n/a
3 TRCN0000007362 CGATTCTTCAAAGCTGTGAAT pLKO.1 3047 CDS 100% 4.950 3.960 N USP9X n/a
4 TRCN0000315063 CGATTCTTCAAAGCTGTGAAT pLKO_005 3047 CDS 100% 4.950 3.960 N USP9X n/a
5 TRCN0000238351 TTCTGTGTCTGGCTAATATTT pLKO_005 8550 3UTR 100% 15.000 10.500 N Usp9x n/a
6 TRCN0000011091 CCACCTCAAACCAAGGATCAA pLKO.1 8465 CDS 100% 4.950 3.465 N USP9X n/a
7 TRCN0000007361 GAGAGTTTATTCACTGTCTTA pLKO.1 8607 3UTR 100% 4.950 3.465 N USP9X n/a
8 TRCN0000315128 GAGAGTTTATTCACTGTCTTA pLKO_005 8607 3UTR 100% 4.950 3.465 N USP9X n/a
9 TRCN0000007364 CGCCTGATTCTTCCAATGAAA pLKO.1 927 CDS 100% 5.625 3.375 N USP9X n/a
10 TRCN0000350481 CGCCTGATTCTTCCAATGAAA pLKO_005 927 CDS 100% 5.625 3.375 N USP9X n/a
11 TRCN0000030761 GCAGAAGAAATCACTATGATT pLKO.1 6932 CDS 100% 5.625 3.375 N Usp9x n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039591.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.