Transcript: Human NM_001039651.1

Homo sapiens suppressor APC domain containing 1 (SAPCD1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SAPCD1 (401251)
Length:
917
CDS:
60..596

Additional Resources:

NCBI RefSeq record:
NM_001039651.1
NBCI Gene record:
SAPCD1 (401251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264015 GCTCCAGGTAGTGAGTCAATG pLKO_005 684 3UTR 100% 10.800 5.400 Y SAPCD1 n/a
2 TRCN0000282898 TCTGTTTGCAGAATCTGATTC pLKO_005 382 CDS 100% 10.800 5.400 Y SAPCD1 n/a
3 TRCN0000264014 TGCACCACCCAGGATTCAAAG pLKO_005 444 CDS 100% 10.800 5.400 Y SAPCD1 n/a
4 TRCN0000009852 CAATGAAGTTCAGACATGTTG pLKO.1 700 3UTR 100% 4.950 2.475 Y MSH5 n/a
5 TRCN0000039953 CCACCCAGGATTCAAAGGAAA pLKO.1 448 CDS 100% 4.950 2.475 Y MSH5 n/a
6 TRCN0000264016 TCCACTGAACAAGGCTAGTTC pLKO_005 422 CDS 100% 4.950 2.475 Y SAPCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05644 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05644 pLX_304 0% 100% 100% V5 n/a
Download CSV