Transcript: Mouse NM_001039701.3

Mus musculus interleukin 1 receptor antagonist (Il1rn), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Il1rn (16181)
Length:
2480
CDS:
83..619

Additional Resources:

NCBI RefSeq record:
NM_001039701.3
NBCI Gene record:
Il1rn (16181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039701.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067154 CCTTATAGTCACGAAGTTCTA pLKO.1 580 CDS 100% 4.950 6.930 N Il1rn n/a
2 TRCN0000325767 CCTTATAGTCACGAAGTTCTA pLKO_005 580 CDS 100% 4.950 6.930 N Il1rn n/a
3 TRCN0000067155 CCTTCAGAATCTGGGATACTA pLKO.1 195 CDS 100% 5.625 3.938 N Il1rn n/a
4 TRCN0000325760 CCTTCAGAATCTGGGATACTA pLKO_005 195 CDS 100% 5.625 3.938 N Il1rn n/a
5 TRCN0000067157 CATCACTGATCTGAGCAAGAA pLKO.1 412 CDS 100% 4.950 3.465 N Il1rn n/a
6 TRCN0000325688 CATCACTGATCTGAGCAAGAA pLKO_005 412 CDS 100% 4.950 3.465 N Il1rn n/a
7 TRCN0000067153 CCTGAGAAACAACCAGCTCAT pLKO.1 232 CDS 100% 4.050 2.835 N Il1rn n/a
8 TRCN0000325690 CCTGAGAAACAACCAGCTCAT pLKO_005 232 CDS 100% 4.050 2.835 N Il1rn n/a
9 TRCN0000067156 TGGTGCCTATTGACCTTCATA pLKO.1 303 CDS 100% 5.625 3.375 N Il1rn n/a
10 TRCN0000325759 TGGTGCCTATTGACCTTCATA pLKO_005 303 CDS 100% 5.625 3.375 N Il1rn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039701.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.