Transcript: Human NM_001040032.2

Homo sapiens chromosome 8 open reading frame 74 (C8orf74), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C8orf74 (203076)
Length:
1042
CDS:
39..923

Additional Resources:

NCBI RefSeq record:
NM_001040032.2
NBCI Gene record:
C8orf74 (203076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264226 CCTTCATCCGCCACTACAAAC pLKO_005 388 CDS 100% 10.800 15.120 N C8orf74 n/a
2 TRCN0000264227 AGCGAAGGCAAGGAAGTAGAA pLKO_005 905 CDS 100% 4.950 3.960 N C8orf74 n/a
3 TRCN0000264228 TCTACGAGAGCATCATCTTTG pLKO_005 181 CDS 100% 10.800 7.560 N C8orf74 n/a
4 TRCN0000264225 CCAGAACACATTCGCCATCTT pLKO_005 761 CDS 100% 4.950 3.465 N C8orf74 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05207 pDONR223 100% 99.8% 99.6% None 43C>T n/a
2 ccsbBroad304_05207 pLX_304 0% 99.8% 99.6% V5 43C>T n/a
3 TRCN0000465453 TGACGAGAATAAGATGAGGTGATC pLX_317 20.3% 99.8% 99.6% V5 43C>T n/a
Download CSV