Transcript: Human NM_001040114.1

Homo sapiens myosin heavy chain 11 (MYH11), transcript variant SM1B, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MYH11 (4629)
Length:
6903
CDS:
108..6047

Additional Resources:

NCBI RefSeq record:
NM_001040114.1
NBCI Gene record:
MYH11 (4629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148074 GAGTTCTCCATCATCCATTAT pLKO.1 1848 CDS 100% 13.200 18.480 N MYH11 n/a
2 TRCN0000147750 GAGGACGTAGAGTTATTGAAA pLKO.1 5956 CDS 100% 5.625 7.875 N MYH11 n/a
3 TRCN0000364157 AGTTCTCCATCATCCATTATG pLKO_005 1849 CDS 100% 13.200 9.240 N MYH11 n/a
4 TRCN0000368587 ATTAGTGACTTAACGACAAAT pLKO_005 3150 CDS 100% 13.200 9.240 N MYH11 n/a
5 TRCN0000110527 GCCTGCATTCTCATGATCAAA pLKO.1 2364 CDS 100% 5.625 3.938 N Myh11 n/a
6 TRCN0000149433 GAAGTTCCTCTTTGTGGACAA pLKO.1 140 CDS 100% 4.050 2.835 N MYH11 n/a
7 TRCN0000149898 CGAGATTTGAAGATCACCGAT pLKO.1 2472 CDS 100% 2.640 1.848 N MYH11 n/a
8 TRCN0000378368 GGTACTTCTCAGGGCTAATAT pLKO_005 430 CDS 100% 15.000 9.000 N MYH11 n/a
9 TRCN0000148652 CCCTGGCAATTCTGTTTACAT pLKO.1 6601 3UTR 100% 5.625 3.375 N MYH11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.