Transcript: Human NM_001040412.2

Homo sapiens chromosome 9 open reading frame 131 (C9orf131), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
C9orf131 (138724)
Length:
3283
CDS:
51..3146

Additional Resources:

NCBI RefSeq record:
NM_001040412.2
NBCI Gene record:
C9orf131 (138724)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143536 GCTGAAGCTGTGAAGATTGAA pLKO.1 2112 CDS 100% 5.625 3.938 N C9orf131 n/a
2 TRCN0000142817 CAGAAGCTACATGGAAGGATA pLKO.1 1522 CDS 100% 4.950 3.465 N C9orf131 n/a
3 TRCN0000141670 CCTAGCTGAAGCTGTGAAGAT pLKO.1 2108 CDS 100% 4.950 3.465 N C9orf131 n/a
4 TRCN0000142204 GCCATGTTCTCCTACCAAAGA pLKO.1 260 CDS 100% 4.950 3.465 N C9orf131 n/a
5 TRCN0000122404 GCTGAAACTCAGGCTGAAGAA pLKO.1 2264 CDS 100% 4.950 3.465 N C9orf131 n/a
6 TRCN0000141336 CAAAGCTTTGTGGGAGACCAT pLKO.1 1388 CDS 100% 2.640 1.848 N C9orf131 n/a
7 TRCN0000143019 CTTCTTCAACAAGCTTGCCTT pLKO.1 590 CDS 100% 2.640 1.848 N C9orf131 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.