Transcript: Human NM_001040444.2

Homo sapiens PHD finger protein 11 (PHF11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PHF11 (51131)
Length:
1402
CDS:
186..1064

Additional Resources:

NCBI RefSeq record:
NM_001040444.2
NBCI Gene record:
PHF11 (51131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358520 ATCGCTCAAAGTGCTAAATTT pLKO_005 561 CDS 100% 15.000 7.500 Y PHF11 n/a
2 TRCN0000020113 CATCGCTCAAAGTGCTAAATT pLKO.1 560 CDS 100% 15.000 7.500 Y PHF11 n/a
3 TRCN0000378317 CCACCGTGGGATGTGATTTAA pLKO_005 421 CDS 100% 15.000 7.500 Y PHF11 n/a
4 TRCN0000020109 CCCAAAGATGTCGAATATAAT pLKO.1 213 CDS 100% 15.000 7.500 Y PHF11 n/a
5 TRCN0000020110 CCCGAAACAATGAAATGTAAT pLKO.1 642 CDS 100% 13.200 6.600 Y PHF11 n/a
6 TRCN0000378271 CTGATGGAGTTCGAGGAATTT pLKO_005 502 CDS 100% 13.200 6.600 Y PHF11 n/a
7 TRCN0000020111 CGAGGAATTTATAAACTGCTT pLKO.1 513 CDS 100% 2.640 1.320 Y PHF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08228 pDONR223 100% 99.8% 100% None 54A>G n/a
2 ccsbBroad304_08228 pLX_304 0% 99.8% 100% V5 54A>G n/a
Download CSV