Transcript: Mouse NM_001040691.1

Mus musculus uracil DNA glycosylase (Ung), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Ung (22256)
Length:
1934
CDS:
69..989

Additional Resources:

NCBI RefSeq record:
NM_001040691.1
NBCI Gene record:
Ung (22256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001040691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124786 GATCCCTATCACGGACCTAAT pLKO.1 507 CDS 100% 10.800 15.120 N Ung n/a
2 TRCN0000317249 GATCCCTATCACGGACCTAAT pLKO_005 507 CDS 100% 10.800 15.120 N Ung n/a
3 TRCN0000124785 GCCGTACTTCGTCAAGCTAAT pLKO.1 371 CDS 100% 10.800 15.120 N Ung n/a
4 TRCN0000317248 GCCGTACTTCGTCAAGCTAAT pLKO_005 371 CDS 100% 10.800 15.120 N Ung n/a
5 TRCN0000124787 CGTCAAGCTAATGGGATTTGT pLKO.1 380 CDS 100% 5.625 4.500 N Ung n/a
6 TRCN0000317320 CGTCAAGCTAATGGGATTTGT pLKO_005 380 CDS 100% 5.625 4.500 N Ung n/a
7 TRCN0000124788 GTCAAGCTAATGGGATTTGTT pLKO.1 381 CDS 100% 5.625 4.500 N Ung n/a
8 TRCN0000124784 CCGCTTTATCCTTTAGAGTTA pLKO.1 1329 3UTR 100% 4.950 3.960 N Ung n/a
9 TRCN0000313734 TGACACGGATAGATCTCTATA pLKO_005 1093 3UTR 100% 13.200 9.240 N Ung n/a
10 TRCN0000313735 GGAACCACCACAAGGTCTATC pLKO_005 412 CDS 100% 10.800 7.560 N Ung n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.