Transcript: Mouse NM_001042503.2

Mus musculus tripartite motif-containing 71 (Trim71), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trim71 (636931)
Length:
5197
CDS:
1253..3820

Additional Resources:

NCBI RefSeq record:
NM_001042503.2
NBCI Gene record:
Trim71 (636931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255216 ATGTTGGAAAGATAGGATTTA pLKO_005 4276 3UTR 100% 13.200 9.240 N Trim71 n/a
2 TRCN0000255219 TTCTTGAGAATACTGTGTTTA pLKO_005 4323 3UTR 100% 13.200 9.240 N Trim71 n/a
3 TRCN0000255217 TTTGCTAAGAAACTCGATTTA pLKO_005 4642 3UTR 100% 13.200 9.240 N Trim71 n/a
4 TRCN0000255215 CTCAGGACTCTAGGTTGAAAG pLKO_005 4664 3UTR 100% 10.800 7.560 N Trim71 n/a
5 TRCN0000245956 GCAGCTTCCTGTGCAAGTTTG pLKO_005 3687 CDS 100% 10.800 7.560 N TRIM71 n/a
6 TRCN0000245958 TGAGCCTGTGAAGTGATAATT pLKO_005 4056 3UTR 100% 15.000 9.000 N TRIM71 n/a
7 TRCN0000255218 TGAGCCTGTGAAGTGATAATT pLKO_005 4056 3UTR 100% 15.000 9.000 N Trim71 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.