Transcript: Human NM_001042681.2

Homo sapiens arginine-glutamic acid dipeptide repeats (RERE), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
RERE (473)
Length:
8009
CDS:
626..5326

Additional Resources:

NCBI RefSeq record:
NM_001042681.2
NBCI Gene record:
RERE (473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329758 TTGGTTCAGGATCGACATAAT pLKO_005 1226 CDS 100% 13.200 18.480 N RERE n/a
2 TRCN0000013580 CCGCCACCGTTTATGTTCAAA pLKO.1 2276 CDS 100% 5.625 7.875 N RERE n/a
3 TRCN0000353623 TGGAATCCAAGAGCTATAATT pLKO_005 5753 3UTR 100% 15.000 10.500 N RERE n/a
4 TRCN0000329700 GCCGTGTTCAGGAGGATTAAG pLKO_005 1994 CDS 100% 13.200 9.240 N RERE n/a
5 TRCN0000329757 TGATCACCTTCTATTACTATT pLKO_005 1917 CDS 100% 13.200 9.240 N RERE n/a
6 TRCN0000013582 CCTAGTCATCAGGCCAAACTT pLKO.1 1493 CDS 100% 5.625 3.938 N RERE n/a
7 TRCN0000013581 CCAGTCAGCTAGGTTCTACAA pLKO.1 4009 CDS 100% 4.950 3.465 N RERE n/a
8 TRCN0000329756 CCAGTCAGCTAGGTTCTACAA pLKO_005 4009 CDS 100% 4.950 3.465 N RERE n/a
9 TRCN0000013579 CCGTATTTCATCTGTAGCATT pLKO.1 986 CDS 100% 4.950 2.475 Y RERE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.