Transcript: Human NM_001042723.2

Homo sapiens ryanodine receptor 1 (RYR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
RYR1 (6261)
Length:
15385
CDS:
140..15241

Additional Resources:

NCBI RefSeq record:
NM_001042723.2
NBCI Gene record:
RYR1 (6261)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359103 CTCTGCATCATTGGCTATAAT pLKO_005 14093 CDS 100% 15.000 21.000 N RYR1 n/a
2 TRCN0000359102 CAACACCACCACGTACTATTA pLKO_005 4420 CDS 100% 13.200 18.480 N RYR1 n/a
3 TRCN0000359171 GCTCCAACCAAGATCTTATTA pLKO_005 1980 CDS 100% 15.000 10.500 N RYR1 n/a
4 TRCN0000053297 CCGCCTCTTTCATGGACATAT pLKO.1 796 CDS 100% 13.200 9.240 N RYR1 n/a
5 TRCN0000359104 CGAAGCGGATGAGAACGAAAT pLKO_005 12466 CDS 100% 10.800 7.560 N RYR1 n/a
6 TRCN0000053294 CCGGGAATTTCTGCACAACAA pLKO.1 10771 CDS 100% 4.950 3.465 N RYR1 n/a
7 TRCN0000053293 CGACAGGATTTGCTTGACTTT pLKO.1 6221 CDS 100% 4.950 3.465 N RYR1 n/a
8 TRCN0000174210 CGACAGGATTTGCTTGACTTT pLKO.1 6221 CDS 100% 4.950 3.465 N RYR1 n/a
9 TRCN0000053295 GCTTCTCTAATCCGTGGCAAT pLKO.1 1715 CDS 100% 4.050 2.835 N RYR1 n/a
10 TRCN0000053296 GCCTCTAACAAGGAGAAGGAA pLKO.1 9230 CDS 100% 3.000 2.100 N RYR1 n/a
11 TRCN0000069749 GCCTTCAACTTCTTCCGCAAA pLKO.1 14690 CDS 100% 4.050 2.430 N LOC381861 n/a
12 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 5757 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.