Transcript: Human NM_001077197.1

Homo sapiens phosphodiesterase 11A (PDE11A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PDE11A (50940)
Length:
8316
CDS:
100..2151

Additional Resources:

NCBI RefSeq record:
NM_001077197.1
NBCI Gene record:
PDE11A (50940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431149 CATACTCCGACTGGCTAATAA pLKO_005 743 CDS 100% 15.000 21.000 N PDE11A n/a
2 TRCN0000432758 CGTGATATATTTCGATCAATG pLKO_005 1759 CDS 100% 10.800 15.120 N PDE11A n/a
3 TRCN0000412621 GAATCACCAGTGGTGAAATTT pLKO_005 643 CDS 100% 15.000 10.500 N PDE11A n/a
4 TRCN0000421398 GCTCTTGATGTGCTATCATAC pLKO_005 1078 CDS 100% 10.800 7.560 N PDE11A n/a
5 TRCN0000048926 CGGGAGAGATTAGAGCTCAAA pLKO.1 1879 CDS 100% 4.950 3.465 N PDE11A n/a
6 TRCN0000174085 CGGGAGAGATTAGAGCTCAAA pLKO.1 1879 CDS 100% 4.950 3.465 N PDE11A n/a
7 TRCN0000048923 CGCTGTACTTTGAGAGGAGAA pLKO.1 1682 CDS 100% 4.050 2.835 N PDE11A n/a
8 TRCN0000048927 GCGATAAATAAGATTCCTGAA pLKO.1 370 CDS 100% 4.050 2.835 N PDE11A n/a
9 TRCN0000242016 TGTGGAATCGCCATATCTAAT pLKO_005 445 CDS 100% 13.200 18.480 N Pde11a n/a
10 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 3758 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
11 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3786 3UTR 100% 4.950 2.475 Y C16orf89 n/a
12 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 3906 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.