Transcript: Mouse NM_001078646.1

Mus musculus HEN1 methyltransferase homolog 1 (Arabidopsis) (Henmt1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Mus musculus (mouse)
Gene:
Henmt1 (66715)
Length:
1806
CDS:
158..1345

Additional Resources:

NCBI RefSeq record:
NM_001078646.1
NBCI Gene record:
Henmt1 (66715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001078646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283029 TGAGGGACGCCGACCATAAAT pLKO_005 687 CDS 100% 15.000 21.000 N Henmt1 n/a
2 TRCN0000264414 ACAACCTCCTACCCGAGTTTA pLKO_005 923 CDS 100% 13.200 10.560 N Henmt1 n/a
3 TRCN0000264412 CATCGCTTGTCTCCCTATTTG pLKO_005 425 CDS 100% 13.200 10.560 N Henmt1 n/a
4 TRCN0000264411 CGGTTCAAACCACCATTATAC pLKO_005 236 CDS 100% 13.200 10.560 N Henmt1 n/a
5 TRCN0000217036 CATCCTCAGCCCTAGAATTTA pLKO.1 1478 3UTR 100% 15.000 10.500 N Henmt1 n/a
6 TRCN0000264413 CATCCTCAGCCCTAGAATTTA pLKO_005 1478 3UTR 100% 15.000 10.500 N Henmt1 n/a
7 TRCN0000189846 GAGTTTCAGACCTGGGCTTTA pLKO.1 725 CDS 100% 10.800 7.560 N Henmt1 n/a
8 TRCN0000190873 CCAGATTTCCTGATGTGGTTT pLKO.1 588 CDS 100% 4.950 3.465 N Henmt1 n/a
9 TRCN0000190144 GAGGCTGAGATACCAGAGAAT pLKO.1 1006 CDS 100% 4.950 3.465 N Henmt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001078646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.