Transcript: Human NM_001080413.3

Homo sapiens NOBOX oogenesis homeobox (NOBOX), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
NOBOX (135935)
Length:
2076
CDS:
1..2076

Additional Resources:

NCBI RefSeq record:
NM_001080413.3
NBCI Gene record:
NOBOX (135935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016998 CCACCATTGAAACACTCGAAT pLKO.1 998 CDS 100% 4.950 6.930 N NOBOX n/a
2 TRCN0000017000 GATCCCTTAGAGATACCTGAA pLKO.1 220 CDS 100% 4.050 5.670 N NOBOX n/a
3 TRCN0000017001 CTAGAGAAGATATTCCAAGAA pLKO.1 859 CDS 100% 4.950 3.465 N NOBOX n/a
4 TRCN0000016999 GCTGACTTCTGACCAGACTTT pLKO.1 1254 CDS 100% 4.950 2.970 N NOBOX n/a
5 TRCN0000017002 TGGCTCTTTCAGCTCCTTCTT pLKO.1 147 CDS 100% 4.950 2.970 N NOBOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.