Transcript: Human NM_001080434.1

Homo sapiens lemur tyrosine kinase 3 (LMTK3), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LMTK3 (114783)
Length:
4972
CDS:
1..4470

Additional Resources:

NCBI RefSeq record:
NM_001080434.1
NBCI Gene record:
LMTK3 (114783)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282433 TTTCGAGTGGGCGGAGGATTT pLKO_005 4323 CDS 100% 10.800 15.120 N LMTK3 n/a
2 TRCN0000021484 CGGAACTGAACTGAACTCTTT pLKO.1 4745 3UTR 100% 4.950 6.930 N LMTK3 n/a
3 TRCN0000021486 GCGGACTACTGGTATGACATT pLKO.1 1228 CDS 100% 4.950 6.930 N LMTK3 n/a
4 TRCN0000358261 TCCATAGAGAGCCGCCTTTCT pLKO_005 4724 3UTR 100% 4.950 6.930 N LMTK3 n/a
5 TRCN0000199025 CGGGAGGATGTGACAAGGAAC pLKO.1 2686 CDS 100% 1.350 1.890 N LMTK3 n/a
6 TRCN0000199202 CGCTGCCTGATGTCTACATTC pLKO.1 374 CDS 100% 10.800 8.640 N LMTK3 n/a
7 TRCN0000368516 CGGACTACTGGTATGACATTC pLKO_005 1229 CDS 100% 10.800 8.640 N LMTK3 n/a
8 TRCN0000358260 ATGTCGGCTTCAAGGAATTTG pLKO_005 284 CDS 100% 13.200 9.240 N LMTK3 n/a
9 TRCN0000358259 CTGCCGTTTCTGCTGATTATG pLKO_005 697 CDS 100% 13.200 9.240 N LMTK3 n/a
10 TRCN0000021487 GCTGCCGTTTCTGCTGATTAT pLKO.1 696 CDS 100% 13.200 9.240 N LMTK3 n/a
11 TRCN0000262810 GGAACAGCGAGCAGATCAAAG pLKO_005 3743 CDS 100% 10.800 7.560 N LMTK3 n/a
12 TRCN0000282431 TGAGCTACCTGCAGGAGATTG pLKO_005 485 CDS 100% 10.800 7.560 N LMTK3 n/a
13 TRCN0000021488 CGGCTTCAAGGAATTTGAGAA pLKO.1 288 CDS 100% 4.950 3.465 N LMTK3 n/a
14 TRCN0000262811 CGTGAGCAGCGAGTACTACAT pLKO_005 1686 CDS 100% 4.950 3.465 N LMTK3 n/a
15 TRCN0000021485 GCCACGACTATTCTTGGACTT pLKO.1 3708 CDS 100% 4.050 2.835 N LMTK3 n/a
16 TRCN0000199507 GCCTTCACACTCAGACATGAC pLKO.1 435 CDS 100% 4.050 2.835 N LMTK3 n/a
17 TRCN0000199749 GCCTCTGATCTCCAATTGCAG pLKO.1 1288 CDS 100% 2.640 1.848 N LMTK3 n/a
18 TRCN0000199869 GAGCCGCCTTTCTCGGAACTG pLKO.1 4732 3UTR 100% 0.000 0.000 N LMTK3 n/a
19 TRCN0000199930 GCTGTGCTTCTCCCGCTTCTC pLKO.1 4371 CDS 100% 0.000 0.000 N LMTK3 n/a
20 TRCN0000023378 CCTACGCTGTGGTCCTCATTT pLKO.1 200 CDS 100% 13.200 7.920 N Lmtk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.