Transcript: Human NM_001080456.2

Homo sapiens zinc finger and SCAN domain containing 5B (ZSCAN5B), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ZSCAN5B (342933)
Length:
1626
CDS:
1..1488

Additional Resources:

NCBI RefSeq record:
NM_001080456.2
NBCI Gene record:
ZSCAN5B (342933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218728 GCTCGGCAAAGAATATCTTAT pLKO_005 399 CDS 100% 13.200 9.240 N ZSCAN5B n/a
2 TRCN0000230664 GTGTGCAATAAATCATTTAAG pLKO_005 1075 CDS 100% 13.200 9.240 N ZSCAN5B n/a
3 TRCN0000230662 AGAAATGGTCTATAGTCAACT pLKO_005 377 CDS 100% 4.950 3.465 N ZSCAN5B n/a
4 TRCN0000230665 TCTCTGTCGGAAGCGCTTCTT pLKO_005 1158 CDS 100% 4.950 2.970 N ZSCAN5B n/a
5 TRCN0000230663 CCCAATCTGGTGAGAGCAAAG pLKO_005 736 CDS 100% 6.000 3.000 Y ZSCAN5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04057 pDONR223 100% 89.2% 79% None (many diffs) n/a
2 ccsbBroad304_04057 pLX_304 0% 89.2% 79% V5 (many diffs) n/a
3 TRCN0000469478 CGCTGCCAATCCTCCGATCTCTAG pLX_317 26% 89.2% 79% V5 (many diffs) n/a
Download CSV