Transcript: Human NM_001080463.2

Homo sapiens dynein cytoplasmic 2 heavy chain 1 (DYNC2H1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DYNC2H1 (79659)
Length:
13704
CDS:
150..13094

Additional Resources:

NCBI RefSeq record:
NM_001080463.2
NBCI Gene record:
DYNC2H1 (79659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050899 CCCGGTTTGATGCACTGATAA pLKO.1 5896 CDS 100% 13.200 18.480 N DYNC2H1 n/a
2 TRCN0000288798 CCCGGTTTGATGCACTGATAA pLKO_005 5896 CDS 100% 13.200 18.480 N DYNC2H1 n/a
3 TRCN0000050901 CCTGGCAAGTAGTATCTCTAA pLKO.1 3494 CDS 100% 4.950 6.930 N DYNC2H1 n/a
4 TRCN0000288797 CCTGGCAAGTAGTATCTCTAA pLKO_005 3494 CDS 100% 4.950 6.930 N DYNC2H1 n/a
5 TRCN0000050898 CGGCGCTTATTTCGTGACAAA pLKO.1 7743 CDS 100% 4.950 6.930 N DYNC2H1 n/a
6 TRCN0000288724 CGGCGCTTATTTCGTGACAAA pLKO_005 7743 CDS 100% 4.950 6.930 N DYNC2H1 n/a
7 TRCN0000050902 CCTGTGCAATATAATCCATAT pLKO.1 1257 CDS 100% 10.800 7.560 N DYNC2H1 n/a
8 TRCN0000288726 CCTGTGCAATATAATCCATAT pLKO_005 1257 CDS 100% 10.800 7.560 N DYNC2H1 n/a
9 TRCN0000178143 GCAGAAGTTCATCCCAACTTT pLKO.1 11601 CDS 100% 0.563 0.394 N Dync2h1 n/a
10 TRCN0000050900 GCCAGCAAGATGTACTTCATT pLKO.1 10665 CDS 100% 5.625 3.375 N DYNC2H1 n/a
11 TRCN0000288723 GCCAGCAAGATGTACTTCATT pLKO_005 10665 CDS 100% 5.625 3.375 N DYNC2H1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.