Transcript: Human NM_001080506.3

Homo sapiens transmembrane protein 150C (TMEM150C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
TMEM150C (441027)
Length:
3178
CDS:
94..843

Additional Resources:

NCBI RefSeq record:
NM_001080506.3
NBCI Gene record:
TMEM150C (441027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269205 TGTCGAAATACACGCTGTTAC pLKO_005 1031 3UTR 100% 10.800 15.120 N TMEM150C n/a
2 TRCN0000283930 TTACCGCTATGAGATTGTTTG pLKO_005 744 CDS 100% 10.800 15.120 N TMEM150C n/a
3 TRCN0000269206 TGTGAAGCATGCACCATATAT pLKO_005 237 CDS 100% 15.000 10.500 N TMEM150C n/a
4 TRCN0000197835 GAATGACCTTACTTGGTAATT pLKO.1 431 CDS 100% 13.200 9.240 N Tmem150c n/a
5 TRCN0000269204 TAGCTGTTCTGCGCTTCATAC pLKO_005 338 CDS 100% 10.800 7.560 N TMEM150C n/a
6 TRCN0000182591 GCCTGTCAGAAGCTTCTGAAT pLKO.1 803 CDS 100% 0.495 0.347 N Tmem150c n/a
7 TRCN0000283928 TAAACCCGTGGCTGAATATTA pLKO_005 377 CDS 100% 15.000 9.000 N TMEM150C n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2282 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2282 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 936 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2280 3UTR 100% 4.950 2.475 Y ERN2 n/a
12 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2280 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2280 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.