Transcript: Mouse NM_001080706.1

Mus musculus B-TFIID TATA-box binding protein associated factor 1 (Btaf1), mRNA.

Source:
NCBI, updated 2015-12-16
Taxon:
Mus musculus (mouse)
Gene:
Btaf1 (107182)
Length:
8509
CDS:
310..5856

Additional Resources:

NCBI RefSeq record:
NM_001080706.1
NBCI Gene record:
Btaf1 (107182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244213 ACTGCTAATTACAGGATTATT pLKO_005 4576 CDS 100% 15.000 21.000 N Btaf1 n/a
2 TRCN0000238941 ATAGCACGCCAACGGAAATTA pLKO_005 730 CDS 100% 15.000 21.000 N Btaf1 n/a
3 TRCN0000238938 CGATATGGCAAACCTATATTA pLKO_005 4696 CDS 100% 15.000 21.000 N Btaf1 n/a
4 TRCN0000238940 ATCTACTACAGATCGATTAAA pLKO_005 591 CDS 100% 15.000 12.000 N Btaf1 n/a
5 TRCN0000238939 AGTTACCTTCTGCTGATATTC pLKO_005 5900 3UTR 100% 13.200 9.240 N Btaf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473265 CTGACTACCTTCCTCTTTTGTCCC pLX_317 9.5% 91.3% 96.2% V5 (many diffs) n/a
Download CSV