Transcript: Mouse NM_001080769.1

Mus musculus UHRF1 (ICBP90) binding protein 1 (Uhrf1bp1), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Uhrf1bp1 (224648)
Length:
8567
CDS:
245..4534

Additional Resources:

NCBI RefSeq record:
NM_001080769.1
NBCI Gene record:
Uhrf1bp1 (224648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252368 CATCTGTCCCGGTTCACTAAG pLKO_005 278 CDS 100% 10.800 15.120 N Uhrf1bp1 n/a
2 TRCN0000064774 CCCGGTTCACTAAGAATCTTT pLKO.1 285 CDS 100% 5.625 7.875 N UHRF1BP1 n/a
3 TRCN0000252371 AGGATCACTTGAATTAGTTTA pLKO_005 6810 3UTR 100% 13.200 9.240 N Uhrf1bp1 n/a
4 TRCN0000252369 GCAGTTTAAAGCCATCTATAA pLKO_005 1921 CDS 100% 13.200 9.240 N Uhrf1bp1 n/a
5 TRCN0000258193 CTTGAAGGTGAACGAAGTATC pLKO_005 3799 CDS 100% 10.800 7.560 N Uhrf1bp1 n/a
6 TRCN0000252370 GTTGTAGCTACGGTCACTTTC pLKO_005 2172 CDS 100% 10.800 7.560 N Uhrf1bp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.