Transcript: Mouse NM_001080798.2

Mus musculus AF4/FMR2 family, member 1 (Aff1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Aff1 (17355)
Length:
8328
CDS:
133..3813

Additional Resources:

NCBI RefSeq record:
NM_001080798.2
NBCI Gene record:
Aff1 (17355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360506 AGCAGTGGCGTTAGCAGTAAA pLKO_005 787 CDS 100% 13.200 18.480 N Aff1 n/a
2 TRCN0000235810 CACGTCCTGTCGGTAACATTA pLKO_005 524 CDS 100% 13.200 18.480 N Aff1 n/a
3 TRCN0000244332 ATGGCGATGTTTCGATGTAAG pLKO_005 3352 CDS 100% 10.800 15.120 N Aff1 n/a
4 TRCN0000235807 TTGCCGAATGGTAACGCTAAA pLKO_005 3010 CDS 100% 10.800 15.120 N Aff1 n/a
5 TRCN0000085624 GCGATGTTTCGATGTAAGAAA pLKO.1 3355 CDS 100% 5.625 7.875 N Aff1 n/a
6 TRCN0000085627 CGTACTCCAATGAAGTCCATT pLKO.1 1157 CDS 100% 4.950 6.930 N Aff1 n/a
7 TRCN0000085626 GCCTTCTTTGCCGAATGGTAA pLKO.1 3003 CDS 100% 4.950 6.930 N Aff1 n/a
8 TRCN0000085625 CCGTACTCCAATGAAGTCCAT pLKO.1 1156 CDS 100% 2.640 3.696 N Aff1 n/a
9 TRCN0000235809 GATGACAGAGTACTGATATTT pLKO_005 4362 3UTR 100% 15.000 10.500 N Aff1 n/a
10 TRCN0000085623 CGGGATGCTTGTCCACTTAAA pLKO.1 3937 3UTR 100% 13.200 9.240 N Aff1 n/a
11 TRCN0000360576 GCCTTTGAGAGACACCAAATT pLKO_005 2397 CDS 100% 13.200 9.240 N Aff1 n/a
12 TRCN0000360575 TGGCGAAGGCCCAAGATAAAG pLKO_005 842 CDS 100% 13.200 9.240 N Aff1 n/a
13 TRCN0000235808 CCCATGTCCTTACGGCCTTTA pLKO_005 3629 CDS 100% 10.800 7.560 N Aff1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.